Genetic information
Gene |
yaaA |
Gene ID |
1025603 |
Gene description/product |
hypothetical protein |
Locus tag |
SF0006 |
Organism |
shigella flexneri 2a str. 301 |
Target programme
gRNA sequence:
gRNA1(rev) |
AAAGATCTGTATCAATTCTGGGG(100,85)
|
gRNA2(rev) |
AACGAGGCGCTCGCAGCACAAGG(100,80)
|
Wild type:
Donor:
GC Content Distribution
Window size:30bp
The average GC content is 50.31% in the target region with its ±1000bp section.This region is suitable for PCR screening or sequencing analysis.
Dot Plot
Window size:10bp
ForwardReverse
The ±1000bp section of target region is aligned with itself to determine if there are complex sequence.
Start |
21 |
32 |
181 |
243 |
332 |
375 |
508 |
642 |
677 |
777 |
869 |
977 |
1201 |
1290 |
1505 |
1538 |
1603 |
1796 |
1894 |
2013 |
2163 |
2311 |
2391 |
2498 |
2521 |
End |
30 |
41 |
190 |
252 |
341 |
384 |
518 |
651 |
686 |
786 |
878 |
990 |
1211 |
1300 |
1515 |
1548 |
1613 |
1806 |
1904 |
2022 |
2173 |
2321 |
2410 |
2508 |
2530 |
It is not recommended to design primers in these positions above
Hairpin structure position
Start |
26 |
41 |
76 |
90 |
201 |
231 |
264 |
319 |
362 |
390 |
437 |
475 |
514 |
559 |
609 |
628 |
696 |
729 |
740 |
753 |
804 |
855 |
923 |
958 |
993 |
1027 |
1050 |
1080 |
1114 |
1146 |
1184 |
1209 |
1234 |
1259 |
1330 |
1395 |
1446 |
1474 |
1532 |
1570 |
1593 |
1618 |
1728 |
1784 |
1807 |
1844 |
1897 |
1919 |
1969 |
1998 |
2059 |
2177 |
2206 |
2267 |
2310 |
2385 |
2407 |
2455 |
2476 |
2538 |
2591 |
2616 |
2666 |
2701 |
End |
40 |
75 |
88 |
133 |
221 |
256 |
318 |
349 |
389 |
416 |
446 |
496 |
538 |
569 |
622 |
685 |
722 |
739 |
752 |
776 |
825 |
905 |
946 |
987 |
1025 |
1044 |
1072 |
1105 |
1135 |
1164 |
1202 |
1228 |
1254 |
1316 |
1376 |
1432 |
1461 |
1525 |
1563 |
1580 |
1610 |
1700 |
1764 |
1794 |
1821 |
1865 |
1917 |
1953 |
1980 |
2058 |
2163 |
2185 |
2238 |
2309 |
2336 |
2406 |
2434 |
2471 |
2498 |
2557 |
2614 |
2636 |
2686 |
2715 |
It is not recommended to design primers where there is a potential hairpin structure above
Adjacent genes
|
Gene |
direction |
distance |
Locus tag |
up stream |
NULL |
fw |
153 |
SF0005 |
Down stream |
yaaJ |
rev |
70 |
SF0007 |
The target gene's direction is (reverse)