Genetic information
Gene yaaA
Gene ID 1025603
Gene description/product hypothetical protein
Locus tag SF0006
Organism shigella flexneri 2a str. 301
Target programme
gRNA sequence:
gRNA1(rev) AAAGATCTGTATCAATTCTGGGG(100,85) gRNA2(rev) AACGAGGCGCTCGCAGCACAAGG(100,80)
Wild type:
Donor:
GC Content Distribution
Window size:30bp
The average GC content is 50.31% in the target region with its ±1000bp section.This region is suitable for PCR screening or sequencing analysis.
Dot Plot
Window size:10bp
ForwardReverse
The ±1000bp section of target region is aligned with itself to determine if there are complex sequence.
Start 21 32 181 243 332 375 508 642 677 777 869 977 1201 1290 1505 1538 1603 1796 1894 2013 2163 2311 2391 2498 2521
End 30 41 190 252 341 384 518 651 686 786 878 990 1211 1300 1515 1548 1613 1806 1904 2022 2173 2321 2410 2508 2530
It is not recommended to design primers in these positions above
Hairpin structure position
Start 26 41 76 90 201 231 264 319 362 390 437 475 514 559 609 628 696 729 740 753 804 855 923 958 993 1027 1050 1080 1114 1146 1184 1209 1234 1259 1330 1395 1446 1474 1532 1570 1593 1618 1728 1784 1807 1844 1897 1919 1969 1998 2059 2177 2206 2267 2310 2385 2407 2455 2476 2538 2591 2616 2666 2701
End 40 75 88 133 221 256 318 349 389 416 446 496 538 569 622 685 722 739 752 776 825 905 946 987 1025 1044 1072 1105 1135 1164 1202 1228 1254 1316 1376 1432 1461 1525 1563 1580 1610 1700 1764 1794 1821 1865 1917 1953 1980 2058 2163 2185 2238 2309 2336 2406 2434 2471 2498 2557 2614 2636 2686 2715
It is not recommended to design primers where there is a potential hairpin structure above
Adjacent genes
Gene direction distance Locus tag
up stream NULL fw 153 SF0005
Down stream yaaJ rev 70 SF0007
The target gene's direction is (reverse)