Genetic information
Gene spoIIE
Gene ID 11689640
Gene description/product stage II sporulation protein E
Locus tag BCN_RS00355
Organism Bacillus cereus
Target programme
gRNA sequence:
gRNA1(fw) ATCGGAAGCTAGTTCGTGAATGG(100,91) gRNA2(fw) CTTTAAAAAGGACCAATGCTGGG(100,88)
Wild type:
Donor:
GC Content Distribution
Window size:30bp
The average GC content is 36.74% in the target region with its ±1000bp section.This region is suitable for PCR screening or sequencing analysis.
Dot Plot
Window size:10bp
ForwardReverse
The ±1000bp section of target region is aligned with itself to determine if there are complex sequence.
Start 225 303 419 462 498 745 764 849 874 909 921 937 956 992 1031 1148 1174 1315 1364 1377 1432 1511 1539 1658 1864 1884 1900 1936 1948 1984 2021 2092 2162 2201 2259 2321 2395 2572 2713 2941 3011 3109 3123 3222 3241 3414 3439 3483 3519 3531 3591 3604 3633 3728 3813 3925 3977 4035 4050 4238 4251 4281 4353 4369 4447
End 234 315 428 471 507 757 784 858 883 918 930 947 974 1005 1040 1157 1183 1333 1373 1390 1441 1525 1548 1669 1873 1893 1912 1945 1957 1993 2030 2101 2171 2210 2268 2330 2405 2581 2723 2951 3020 3118 3132 3231 3251 3429 3449 3514 3530 3540 3601 3627 3642 3743 3824 3934 3986 4044 4066 4248 4261 4290 4362 4384 4460
It is not recommended to design primers in these positions above
Hairpin structure position
Start 37 117 134 198 277 300 324 456 480 535 590 611 650 695 717 741 811 885 914 1038 1088 1165 1176 1215 1290 1346 1408 1456 1521 1579 1606 1635 1667 1690 1710 1742 1758 1815 1860 1926 1945 1987 2050 2088 2119 2145 2190 2203 2230 2269 2319 2370 2403 2460 2527 2542 2623 2676 2714 2756 2773 2788 2835 2868 2922 2976 3108 3263 3325 3337 3376 3395 3438 3580 3676 3717 3764 3809 3872 3944 4013 4073 4111 4154 4169 4185 4205 4238 4294 4306 4366 4382 4424
End 106 125 155 261 299 321 445 464 533 581 608 648 691 713 738 794 881 913 996 1052 1108 1172 1211 1245 1298 1392 1450 1478 1550 1600 1630 1662 1680 1702 1739 1756 1782 1851 1916 1942 1973 2014 2080 2108 2128 2182 2202 2212 2268 2291 2335 2393 2429 2495 2537 2585 2647 2696 2729 2769 2787 2827 2867 2892 2958 3041 3173 3309 3336 3360 3393 3405 3566 3669 3691 3738 3783 3850 3934 3961 4053 4105 4145 4167 4184 4201 4221 4262 4301 4350 4380 4415 4451
It is not recommended to design primers where there is a potential hairpin structure above
Adjacent genes
Gene direction distance Locus tag
up stream NULL fw 260 BCN_RS00350
Down stream tilS fw 225 BCN_RS00360
The target gene's direction is (forward)
It may destroy the promoter region of adjacent genes (tilS).