Genetic information
Gene satP
Gene ID 11758056
Gene description/product hypothetical protein
Locus tag STM14_RS00610
Organism Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Target programme
gRNA sequence:
gRNA1(rev) GGCGCTTATTTAGGTCTGTGGGG(100,90) gRNA2(fw) CAGCCAGAACGAACCGTAAGAGG(100,82)
Wild type:
Donor:
GC Content Distribution
Window size:30bp
The average GC content is 52.9% in the target region with its ±1000bp section.This region is suitable for PCR screening or sequencing analysis.
Dot Plot
Window size:10bp
ForwardReverse
The ±1000bp section of target region is aligned with itself to determine if there are complex sequence.
Start 41 170 685 967 982 1010 1059 1144 1187 1443 1801 2184 2275 2358
End 50 179 696 978 993 1019 1070 1155 1196 1454 1811 2193 2285 2367
It is not recommended to design primers in these positions above
Hairpin structure position
Start 5 67 80 168 222 324 347 392 409 443 490 540 641 705 729 777 804 842 878 951 1013 1041 1064 1135 1159 1237 1266 1375 1447 1477 1550 1568 1598 1612 1677 1707 1755 1782 1815 1848 1917 1952 1979 2016 2040 2072 2141 2194 2292 2334 2354 2406 2462 2494 2542
End 23 78 152 217 275 344 371 406 442 487 513 628 680 717 753 797 841 873 925 1003 1038 1053 1096 1152 1181 1248 1300 1421 1473 1525 1562 1592 1608 1647 1705 1753 1778 1806 1823 1908 1944 1971 1999 2029 2064 2088 2185 2243 2324 2352 2393 2432 2491 2533 2567
It is not recommended to design primers where there is a potential hairpin structure above
Adjacent genes
Gene direction distance Locus tag
up stream mog fw 57 STM14_RS00605
Down stream msyB rev 150 STM14_RS00615
The target gene's direction is (reverse)