Genetic information
Gene |
satP |
Gene ID |
11758056 |
Gene description/product |
hypothetical protein |
Locus tag |
STM14_RS00610 |
Organism |
Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
Target programme
gRNA sequence:
gRNA1(rev) |
GGCGCTTATTTAGGTCTGTGGGG(100,90)
|
gRNA2(fw) |
CAGCCAGAACGAACCGTAAGAGG(100,82)
|
Wild type:
Donor:
GC Content Distribution
Window size:30bp
The average GC content is 52.9% in the target region with its ±1000bp section.This region is suitable for PCR screening or sequencing analysis.
Dot Plot
Window size:10bp
ForwardReverse
The ±1000bp section of target region is aligned with itself to determine if there are complex sequence.
Start |
41 |
170 |
685 |
967 |
982 |
1010 |
1059 |
1144 |
1187 |
1443 |
1801 |
2184 |
2275 |
2358 |
End |
50 |
179 |
696 |
978 |
993 |
1019 |
1070 |
1155 |
1196 |
1454 |
1811 |
2193 |
2285 |
2367 |
It is not recommended to design primers in these positions above
Hairpin structure position
Start |
5 |
67 |
80 |
168 |
222 |
324 |
347 |
392 |
409 |
443 |
490 |
540 |
641 |
705 |
729 |
777 |
804 |
842 |
878 |
951 |
1013 |
1041 |
1064 |
1135 |
1159 |
1237 |
1266 |
1375 |
1447 |
1477 |
1550 |
1568 |
1598 |
1612 |
1677 |
1707 |
1755 |
1782 |
1815 |
1848 |
1917 |
1952 |
1979 |
2016 |
2040 |
2072 |
2141 |
2194 |
2292 |
2334 |
2354 |
2406 |
2462 |
2494 |
2542 |
End |
23 |
78 |
152 |
217 |
275 |
344 |
371 |
406 |
442 |
487 |
513 |
628 |
680 |
717 |
753 |
797 |
841 |
873 |
925 |
1003 |
1038 |
1053 |
1096 |
1152 |
1181 |
1248 |
1300 |
1421 |
1473 |
1525 |
1562 |
1592 |
1608 |
1647 |
1705 |
1753 |
1778 |
1806 |
1823 |
1908 |
1944 |
1971 |
1999 |
2029 |
2064 |
2088 |
2185 |
2243 |
2324 |
2352 |
2393 |
2432 |
2491 |
2533 |
2567 |
It is not recommended to design primers where there is a potential hairpin structure above
Adjacent genes
|
Gene |
direction |
distance |
Locus tag |
up stream |
mog |
fw |
57 |
STM14_RS00605 |
Down stream |
msyB |
rev |
150 |
STM14_RS00615 |
The target gene's direction is (reverse)