Genetic information
Gene ompA
Gene ID 945571
Gene description/product outer membrane porin A
Locus tag b0957
Organism K-12 substr. MG1655
Target programme
gRNA sequence:
gRNA1(fw) AGACTTCAGAGTGAAGTGCTTGG(100,85) gRNA2(rev) GTTTCCTACCGTTTCGGTCAGGG(100,85)
Wild type:
Donor:
GC Content Distribution
Window size:30bp
The average GC content is 48.67% in the target region with its ±1000bp section.This region is suitable for PCR screening or sequencing analysis.
Dot Plot
Window size:10bp
ForwardReverse
The ±1000bp section of target region is aligned with itself to determine if there are complex sequence.
Start 302 571 638 739 960 975 1193 1728 1900 1938 2003 2040 2910
End 311 580 648 749 970 985 1206 1738 1909 1948 2012 2050 2920
It is not recommended to design primers in these positions above
Hairpin structure position
Start 41 63 72 109 208 264 284 316 340 387 440 462 642 669 693 713 746 775 882 924 945 959 1046 1084 1124 1174 1231 1278 1505 1553 1572 1614 1690 1721 1741 1771 1783 1798 1840 1908 1948 1976 2006 2019 2043 2079 2129 2177 2269 2336 2357 2440 2457 2507 2605 2634 2656 2720 2739 2774 2805 2845 2884 2930 2977
End 57 71 94 164 253 283 314 338 354 430 460 501 663 692 707 743 766 844 912 941 953 1019 1082 1112 1132 1219 1261 1476 1537 1564 1611 1661 1714 1731 1757 1781 1797 1816 1899 1943 1964 1997 2016 2026 2077 2121 2163 2218 2319 2345 2423 2454 2492 2528 2626 2645 2691 2733 2770 2786 2843 2863 2907 2955 3022
It is not recommended to design primers where there is a potential hairpin structure above
Adjacent genes
Gene direction distance Locus tag
up stream matP fw 76 b0956
Down stream sulA rev 357 b0958
The target gene's direction is (reverse)