Genetic information
Gene |
ompA |
Gene ID |
945571 |
Gene description/product |
outer membrane porin A |
Locus tag |
b0957 |
Organism |
K-12 substr. MG1655 |
Target programme
gRNA sequence:
gRNA1(fw) |
AGACTTCAGAGTGAAGTGCTTGG(100,85)
|
gRNA2(rev) |
GTTTCCTACCGTTTCGGTCAGGG(100,85)
|
Wild type:
Donor:
GC Content Distribution
Window size:30bp
The average GC content is 48.67% in the target region with its ±1000bp section.This region is suitable for PCR screening or sequencing analysis.
Dot Plot
Window size:10bp
ForwardReverse
The ±1000bp section of target region is aligned with itself to determine if there are complex sequence.
Start |
302 |
571 |
638 |
739 |
960 |
975 |
1193 |
1728 |
1900 |
1938 |
2003 |
2040 |
2910 |
End |
311 |
580 |
648 |
749 |
970 |
985 |
1206 |
1738 |
1909 |
1948 |
2012 |
2050 |
2920 |
It is not recommended to design primers in these positions above
Hairpin structure position
Start |
41 |
63 |
72 |
109 |
208 |
264 |
284 |
316 |
340 |
387 |
440 |
462 |
642 |
669 |
693 |
713 |
746 |
775 |
882 |
924 |
945 |
959 |
1046 |
1084 |
1124 |
1174 |
1231 |
1278 |
1505 |
1553 |
1572 |
1614 |
1690 |
1721 |
1741 |
1771 |
1783 |
1798 |
1840 |
1908 |
1948 |
1976 |
2006 |
2019 |
2043 |
2079 |
2129 |
2177 |
2269 |
2336 |
2357 |
2440 |
2457 |
2507 |
2605 |
2634 |
2656 |
2720 |
2739 |
2774 |
2805 |
2845 |
2884 |
2930 |
2977 |
End |
57 |
71 |
94 |
164 |
253 |
283 |
314 |
338 |
354 |
430 |
460 |
501 |
663 |
692 |
707 |
743 |
766 |
844 |
912 |
941 |
953 |
1019 |
1082 |
1112 |
1132 |
1219 |
1261 |
1476 |
1537 |
1564 |
1611 |
1661 |
1714 |
1731 |
1757 |
1781 |
1797 |
1816 |
1899 |
1943 |
1964 |
1997 |
2016 |
2026 |
2077 |
2121 |
2163 |
2218 |
2319 |
2345 |
2423 |
2454 |
2492 |
2528 |
2626 |
2645 |
2691 |
2733 |
2770 |
2786 |
2843 |
2863 |
2907 |
2955 |
3022 |
It is not recommended to design primers where there is a potential hairpin structure above
Adjacent genes
|
Gene |
direction |
distance |
Locus tag |
up stream |
matP |
fw |
76 |
b0956 |
Down stream |
sulA |
rev |
357 |
b0958 |
The target gene's direction is (reverse)