Genetic information
Gene araE
Gene ID 947341
Gene description/product arabinose:H(+) symporter
Locus tag b2841
Organism K-12 substr. MG1655
Target programme
gRNA sequence:
gRNA1(fw) CCCTTTTCCGCCAGCCAGCGCGG(100,80) gRNA2(fw) CGCAATCATCTGTTGTTCTGTGG(100,91)
Wild type:
Donor:
GC Content Distribution
Window size:30bp
The average GC content is 49.93% in the target region with its ±1000bp section.This region is suitable for PCR screening or sequencing analysis.
Dot Plot
Window size:10bp
ForwardReverse
The ±1000bp section of target region is aligned with itself to determine if there are complex sequence.
Start 185 244 268 330 551 596 759 787 968 984 1005 1119 1394 1428 1568 1782 2051 2182 2295 2361 2492 2545 2637 2661 2942 3236 3371
End 194 253 277 339 560 605 768 798 978 994 1014 1128 1404 1440 1578 1791 2061 2193 2304 2371 2510 2554 2648 2671 2951 3245 3380
It is not recommended to design primers in these positions above
Hairpin structure position
Start 48 63 96 149 204 246 305 387 435 526 578 596 655 683 730 747 759 791 822 856 890 968 1020 1052 1115 1156 1179 1226 1235 1288 1310 1343 1386 1425 1502 1555 1585 1614 1662 1712 1734 1801 1835 1890 1911 1990 2013 2066 2129 2157 2189 2276 2323 2358 2380 2426 2449 2493 2519 2537 2575 2753 2826 2879 2943 2988 3098 3129 3199 3266 3290 3331 3372
End 62 71 103 187 223 293 358 407 456 563 593 641 680 707 742 756 785 818 849 868 902 1017 1041 1094 1139 1167 1224 1234 1266 1296 1333 1359 1412 1490 1534 1582 1607 1626 1706 1722 1771 1826 1885 1907 1981 2010 2029 2106 2144 2167 2221 2300 2337 2370 2390 2435 2474 2518 2534 2573 2732 2791 2877 2901 2972 3020 3114 3152 3242 3280 3302 3338 3385
It is not recommended to design primers where there is a potential hairpin structure above
Adjacent genes
Gene direction distance Locus tag
up stream ygeA rev 129 b2840
Down stream kduD rev 315 b2842
The target gene's direction is (reverse)
It may destroy the promoter region of adjacent genes (ygeA).