Genetic information
Gene |
araE |
Gene ID |
947341 |
Gene description/product |
arabinose:H(+) symporter |
Locus tag |
b2841 |
Organism |
K-12 substr. MG1655 |
Target programme
gRNA sequence:
gRNA1(fw) |
CCCTTTTCCGCCAGCCAGCGCGG(100,80)
|
gRNA2(fw) |
CGCAATCATCTGTTGTTCTGTGG(100,91)
|
Wild type:
Donor:
GC Content Distribution
Window size:30bp
The average GC content is 49.93% in the target region with its ±1000bp section.This region is suitable for PCR screening or sequencing analysis.
Dot Plot
Window size:10bp
ForwardReverse
The ±1000bp section of target region is aligned with itself to determine if there are complex sequence.
Start |
185 |
244 |
268 |
330 |
551 |
596 |
759 |
787 |
968 |
984 |
1005 |
1119 |
1394 |
1428 |
1568 |
1782 |
2051 |
2182 |
2295 |
2361 |
2492 |
2545 |
2637 |
2661 |
2942 |
3236 |
3371 |
End |
194 |
253 |
277 |
339 |
560 |
605 |
768 |
798 |
978 |
994 |
1014 |
1128 |
1404 |
1440 |
1578 |
1791 |
2061 |
2193 |
2304 |
2371 |
2510 |
2554 |
2648 |
2671 |
2951 |
3245 |
3380 |
It is not recommended to design primers in these positions above
Hairpin structure position
Start |
48 |
63 |
96 |
149 |
204 |
246 |
305 |
387 |
435 |
526 |
578 |
596 |
655 |
683 |
730 |
747 |
759 |
791 |
822 |
856 |
890 |
968 |
1020 |
1052 |
1115 |
1156 |
1179 |
1226 |
1235 |
1288 |
1310 |
1343 |
1386 |
1425 |
1502 |
1555 |
1585 |
1614 |
1662 |
1712 |
1734 |
1801 |
1835 |
1890 |
1911 |
1990 |
2013 |
2066 |
2129 |
2157 |
2189 |
2276 |
2323 |
2358 |
2380 |
2426 |
2449 |
2493 |
2519 |
2537 |
2575 |
2753 |
2826 |
2879 |
2943 |
2988 |
3098 |
3129 |
3199 |
3266 |
3290 |
3331 |
3372 |
End |
62 |
71 |
103 |
187 |
223 |
293 |
358 |
407 |
456 |
563 |
593 |
641 |
680 |
707 |
742 |
756 |
785 |
818 |
849 |
868 |
902 |
1017 |
1041 |
1094 |
1139 |
1167 |
1224 |
1234 |
1266 |
1296 |
1333 |
1359 |
1412 |
1490 |
1534 |
1582 |
1607 |
1626 |
1706 |
1722 |
1771 |
1826 |
1885 |
1907 |
1981 |
2010 |
2029 |
2106 |
2144 |
2167 |
2221 |
2300 |
2337 |
2370 |
2390 |
2435 |
2474 |
2518 |
2534 |
2573 |
2732 |
2791 |
2877 |
2901 |
2972 |
3020 |
3114 |
3152 |
3242 |
3280 |
3302 |
3338 |
3385 |
It is not recommended to design primers where there is a potential hairpin structure above
Adjacent genes
|
Gene |
direction |
distance |
Locus tag |
up stream |
ygeA |
rev |
129 |
b2840 |
Down stream |
kduD |
rev |
315 |
b2842 |
The target gene's direction is (reverse)
It may destroy the promoter region of adjacent genes (ygeA).