Official symbol | CAV1 |
Gene id | 857 |
Organism | Homo sapiens |
Official full symbol | caveolin 1 |
Gene type | protein-coding |
Also known as | BSCL3, CGL3, LCCNS, MSTP085, PPH3, VIP21 |
Summary | The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1. |
Genomic regions | Chromosome 7 |
Name | Transcript ID | bp | Protein | Biotype | CCDS | UniProt Match | RefSeq Match | Flags |
CAV1-205 | ENST00000405348.6 | 2652 | 147aa | Protein coding | CCDS55156 | Q03135-2 | - | TSL:5, GENCODE basic, APPRIS ALT1, |
CAV1-202 | ENST00000393467.1 | 2628 | 147aa | Protein coding | CCDS55156 | Q03135-2 | - | TSL:1, GENCODE basic, APPRIS ALT1, |
CAV1-201 | ENST00000341049.7 | 2456 | 178aa | Protein coding | CCDS5767 | Q03135-1 | NM_001753.5 | TSL:1, GENCODE basic, APPRIS P3, MANE Select v0.92, |
CAV1-203 | ENST00000393468.1 | 845 | 147aa | Protein coding | CCDS55156 | Q03135-2 | - | TSL:1, GENCODE basic, APPRIS ALT1, |
CAV1-209 | ENST00000614113.5 | 1130 | 115aa | Protein coding | - | Q03135-2 | - | TSL:1, GENCODE basic, |
CAV1-204 | ENST00000393470.1 | 598 | 167aa | Protein coding | - | E9PCT5 | - | TSL:4, GENCODE basic, |
CAV1-207 | ENST00000456473.5 | 557 | 138aa | Protein coding | - | C9JKI3 | - | CDS 3' incomplete, TSL:4, |
CAV1-206 | ENST00000451122.5 | 1653 | 86aa | Nonsense mediated decay | - | F8WDM7 | - | TSL:1, |
CAV1-208 | ENST00000489856.1 | 575 | No protein | Retained intron | - | - | - | TSL:2, |
Target Gene | CAV1 |
This KO Strategy | Normal |
Red Cotton™ Notes | Gene CAV1 had been KO in hela cell line. |
gRNA1(fw):AGTGTACGACGCGCACACCAAGG(98;0.71)
gRNA2(rev):ATGTTGCCCTGTTCCCGGATGGG(94;0.65)
gRNA2(rev):CTCGCTCAGCTCGTCTGCCATGG(83;0.68)
Please leave your suggestion ×