Official symbol | ACE2 |
Gene id | 59272 |
Organism | Homo sapiens |
Official full symbol | angiotensin I converting enzyme 2 |
Gene type | protein-coding |
Also known as | ACEH |
Summary | The protein encoded by this gene belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. ACE2 is known to be expressed in various human organs, and its organ- and cell-specific expression suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronavirus HCoV-NL63 and the human severe acute respiratory syndrome coronaviruses, SARS-CoV and SARS-CoV-2, the causative agent of coronavirus disease-2019 (COVID-19). |
Genomic regions | Chromosome X |
Cell name | PANC-1 |
Tissue | pancreas/duct |
Organism | Human |
Morphology | epithelial |
Culture properties | adherent |
Disease | epithelioid carcinoma |
Complete growth medium | Complete Growth MediumThe base medium for this cell line is ATCC-formulated Dulbecco's Modified Eagle's Medium, Catalog No. 30-2002. To make the complete growth medium, add the following components to the base medium: ·fetal bovine serum to a final concentration of 10%This medium is formulated for use with a 5% CO2 in air atmosphere. (Standard DMEM formulations contain 3.7 g/L sodium bicarbonate and a 10% CO2 in air atmosphere is then recommended).ATCC tested fetal bovine serum is available as ATCC Catalog No. 30-2020. |
Subcultivation ratio | Subcultivation Ratio:A subcultivation ratio of 1:2 to 1:4 is recommended Medium Renewal:2 to 3 times per week |
Name | Transcript ID | bp | Protein | Biotype | CCDS | UniProt Match | RefSeq Match | Flags |
ACE2-202 | ENST00000427411.2 | 7587 | 805aa | Protein coding | CCDS14169 | Q9BYF1-1 | - | TSL:1, GENCODE basic, APPRIS P2, |
ACE2-207 | ENST00000678073.1 | 7487 | 805aa | Protein coding | CCDS14169 | - | - | GENCODE basic, APPRIS P2, |
ACE2-211 | ENST00000680121.1 | 7413 | 805aa | Protein coding | CCDS14169 | - | - | GENCODE basic, APPRIS P2, |
ACE2-201 | ENST00000252519.8 | 3339 | 805aa | Protein coding | CCDS14169 | Q9BYF1-1 | NM_001371415.1 | TSL:1, GENCODE basic, APPRIS P2, MANE Select v0.92, |
ACE2-205 | ENST00000677282.1 | 6372 | 459aa | Protein coding | - | - | - | GENCODE basic, |
ACE2-210 | ENST00000679278.1 | 3149 | 786aa | Protein coding | - | - | - | GENCODE basic, APPRIS ALT2, |
ACE2-206 | ENST00000678046.1 | 2723 | 771aa | Protein coding | - | - | - | GENCODE basic, APPRIS ALT2, |
ACE2-209 | ENST00000679212.1 | 2642 | 772aa | Protein coding | - | - | - | GENCODE basic, APPRIS ALT2, |
ACE2-208 | ENST00000679162.1 | 2730 | 786aa | Nonsense mediated decay | - | - | - | - |
ACE2-203 | ENST00000471548.5 | 998 | 112aa | Nonsense mediated decay | - | - | - | CDS 5' incomplete, TSL:2, |
ACE2-204 | ENST00000473851.1 | 786 | No protein | Retained intron | - | - | - | TSL:3, |
Cell Line | PANC-1 |
Target Gene | ACE2 |
Colony Formation | Intermediate |
This KO Strategy | Normal |
Red Cotton™ Notes | Ubigene has successfully modified PANC-1 cell line. |
gRNA1(fw):TGCTGCTCAGTCCACCATTGAGG(78;0.76)
gRNA2(rev):CAAGTGAACTTTGATAGAACAGG(77;0.72)
Knockout size:58
CDS Knockout size:58
gRNA3(rev):GACATTCTCTTCAGTAATATTGG(65;0.57)
gRNA4(rev):TTACAGCAACAAGGCTGAGAAGG(64;0.63)
Knockout size:134
CDS Knockout size:134
gRNA5(fw):TGCAGGCTCTTCAGCAAAATGGG(76;0.58)
gRNA6(rev):TGGATACATTTGGGCAAGTGTGG(69;0.63)
Knockout size:71
CDS Knockout size:71
Please leave your suggestion ×