CRISPR-U™ Gene Knockout Cell Line Strategy

BAK1 Gene Knockout Strategy

CRISPR-U™ technology (CRISPR based), developed by Ubigene, is more efficient than general CRISPR/Cas9 technology in double-strand breaking and homologous recombination. With CRISPR-U™, Ubigene has successfully edited over 3000 genes on more than 100 types of cell lines.
Objective
To create a Human BAK1 Knockout model in cell line by CRISPR-U™-mediated genome engineering.
Target gene info
Official symbol BAK1
Gene id 578
Organism Homo sapiens
Official full symbol BCL2 antagonist/killer 1
Gene type protein-coding
Also known as BAK, BAK-LIKE, BCL2L7, CDN1
Summary The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form oligomers or heterodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein localizes to mitochondria, and functions to induce apoptosis. It interacts with and accelerates the opening of the mitochondrial voltage-dependent anion channel, which leads to a loss in membrane potential and the release of cytochrome c. This protein also interacts with the tumor suppressor P53 after exposure to cell stress.
Genomic regions Chromosome 6
Strategy Summary
This gene has 3 protein coding transcripts:
Name Transcript ID bp Protein Biotype CCDS UniProt Match RefSeq Match Flags
BAK1-202 ENST00000374467.4 2170 211aa Protein coding CCDS4781 Q16611-1 NM_001188.4 TSL:1, GENCODE basic, APPRIS P1, MANE Select v0.92,
BAK1-203 ENST00000442998.6 2212 153aa Protein coding - Q16611-2 - TSL:1, GENCODE basic,
BAK1-201 ENST00000360661.9 2132 191aa Protein coding - A0A0A0MRG8 - TSL:5, GENCODE basic,
Ubigene Red Cotton Transcript
Strategy
Click to get
Red Cotton™ Assessment    
Project Difficulty Levelloading
Target Gene BAK1
This KO Strategy Normal
Red Cotton™ Notes Gene BAK1 had been KO in hela cell line.
Aforementioned information comes from Ubigene database. Different origin of cell lines may have different condition. Ubigene reserved all the right for final explanation.
Small fragment knockout strategy
  • Pair1

    gRNA sequence:

    gRNA1(fw):AGGGAGGCAGTAGCTCGCATGGG(89;0.72)

    gRNA2(fw):TGAATCCCCTATAAGGCATGGGG(80;0.72)

    Knockout size:243

    CDS Knockout size:136

  • Pair2

    gRNA sequence:

    gRNA3(rev):AGAGAAGGGCAAGACCCCCGAGG(73;0.81)

    gRNA4(rev):AGGGAGAGAGGGCCGAACCCTGG(79;0.74)

    Knockout size:270

    CDS Knockout size:136

  • Pair3

    gRNA sequence:

    gRNA5(rev):GTGGGAGCCCAACATAAAAGAGG(78;0.8)

    gRNA6(fw):TCCATGGGTGAGGACAGCTATGG(71;0.74)

    Knockout size:353

    CDS Knockout size:136

Ubigene Red Cotton gRNA Positions Large
Ubigene Red Cotton gRNA Positions
Ubigene Red Cotton Transcript region
  • 6 exons are identified, with the ATG start codon in Exon 2 and the stop codon in Exon 6 (Transcript: BAK1-201);
  • Exon 3 is the target region, basing on start codon, exons location, exons size, and gRNA scores;
Note:It is possible to adjust the target region according to the actual situation during the experiment.
Data and information refer to following databases: NCBI, Ensembl, Crispor, ATCC.
Overview of the Dot Plot and GC Content Distribution
Dot Plot The ±800bp section of target region is aligned with itself to determine if there are complex sequence.
Ubigene Red Cotton Lattice Diagram
No complex region is found in the dot plot matrix.
GC Content Distribution The average GC content is 0.554147465437788% in the target region with its ±800bp section
Ubigene Red Cotton GC Content
The average GC content is low
Ubigene Red Cotton gRNA Positions Large
Ubigene Red Cotton gRNA Positions
Ubigene Red Cotton Transcript region
  • 6 exons are identified, with the ATG start codon in Exon 2 and the stop codon in Exon 6 (Transcript: BAK1-201);
  • Exon 3 is the target region, basing on start codon, exons location, exons size, and gRNA scores;
Note:It is possible to adjust the target region according to the actual situation during the experiment.
Data and information refer to following databases: NCBI, Ensembl, Crispor, ATCC.
Overview of the Dot Plot and GC Content Distribution
Dot Plot The ±800bp section of target region is aligned with itself to determine if there are complex sequence.
Ubigene Red Cotton Lattice Diagram
No complex region is found in the dot plot matrix.
GC Content Distribution The average GC content is 0.554147465437788% in the target region with its ±800bp section
Ubigene Red Cotton GC Content
The average GC content is low
Ubigene Red Cotton gRNA Positions Large
Ubigene Red Cotton gRNA Positions
Ubigene Red Cotton Transcript region
  • 6 exons are identified, with the ATG start codon in Exon 2 and the stop codon in Exon 6 (Transcript: BAK1-201);
  • Exon 3 is the target region, basing on start codon, exons location, exons size, and gRNA scores;
Note:It is possible to adjust the target region according to the actual situation during the experiment.
Data and information refer to following databases: NCBI, Ensembl, Crispor, ATCC.
Overview of the Dot Plot and GC Content Distribution
Dot Plot The ±800bp section of target region is aligned with itself to determine if there are complex sequence.
Ubigene Red Cotton Lattice Diagram
No complex region is found in the dot plot matrix.
GC Content Distribution The average GC content is 0.554147465437788% in the target region with its ±800bp section
Ubigene Red Cotton GC Content
The average GC content is low
Work flow
Ubigene Red Cotton Workflow

Please leave your suggestion ×

Comment: