Official symbol | BAK1 |
Gene id | 578 |
Organism | Homo sapiens |
Official full symbol | BCL2 antagonist/killer 1 |
Gene type | protein-coding |
Also known as | BAK, BAK-LIKE, BCL2L7, CDN1 |
Summary | The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form oligomers or heterodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein localizes to mitochondria, and functions to induce apoptosis. It interacts with and accelerates the opening of the mitochondrial voltage-dependent anion channel, which leads to a loss in membrane potential and the release of cytochrome c. This protein also interacts with the tumor suppressor P53 after exposure to cell stress. |
Genomic regions | Chromosome 6 |
Name | Transcript ID | bp | Protein | Biotype | CCDS | UniProt Match | RefSeq Match | Flags |
BAK1-202 | ENST00000374467.4 | 2170 | 211aa | Protein coding | CCDS4781 | Q16611-1 | NM_001188.4 | TSL:1, GENCODE basic, APPRIS P1, MANE Select v0.92, |
BAK1-203 | ENST00000442998.6 | 2212 | 153aa | Protein coding | - | Q16611-2 | - | TSL:1, GENCODE basic, |
BAK1-201 | ENST00000360661.9 | 2132 | 191aa | Protein coding | - | A0A0A0MRG8 | - | TSL:5, GENCODE basic, |
Target Gene | BAK1 |
This KO Strategy | Normal |
Red Cotton™ Notes | Gene BAK1 had been KO in hela cell line. |
gRNA1(fw):AGGGAGGCAGTAGCTCGCATGGG(89;0.72)
gRNA2(fw):TGAATCCCCTATAAGGCATGGGG(80;0.72)
Knockout size:243
CDS Knockout size:136
gRNA3(rev):AGAGAAGGGCAAGACCCCCGAGG(73;0.81)
gRNA4(rev):AGGGAGAGAGGGCCGAACCCTGG(79;0.74)
Knockout size:270
CDS Knockout size:136
gRNA5(rev):GTGGGAGCCCAACATAAAAGAGG(78;0.8)
gRNA6(fw):TCCATGGGTGAGGACAGCTATGG(71;0.74)
Knockout size:353
CDS Knockout size:136
Please leave your suggestion ×