Official symbol | ATF3 |
Gene id | 467 |
Organism | Homo sapiens |
Official full symbol | activating transcription factor 3 |
Gene type | protein-coding |
Summary | This gene encodes a member of the mammalian activation transcription factor/cAMP responsive element-binding (CREB) protein family of transcription factors. This gene is induced by a variety of signals, including many of those encountered by cancer cells, and is involved in the complex process of cellular stress response. Multiple transcript variants encoding different isoforms have been found for this gene. It is possible that alternative splicing of this gene may be physiologically important in the regulation of target genes. |
Genomic regions | Chromosome 1 |
Name | Transcript ID | bp | Protein | Biotype | CCDS | UniProt Match | RefSeq Match | Flags |
ATF3-211 | ENST00000613954.4 | 2031 | 124aa | Protein coding | CCDS58059 | P18847-5 | - | TSL:5, GENCODE basic, |
ATF3-202 | ENST00000341491.9 | 1940 | 181aa | Protein coding | CCDS1506 | P18847-1 | NM_001674.4 | TSL:1, GENCODE basic, APPRIS P1, MANE Select v0.92, |
ATF3-206 | ENST00000366987.6 | 1917 | 181aa | Protein coding | CCDS1506 | P18847-1 | - | TSL:1, GENCODE basic, APPRIS P1, |
ATF3-204 | ENST00000366983.5 | 858 | 135aa | Protein coding | CCDS41464 | P18847-3 | - | TSL:1, GENCODE basic, |
ATF3-210 | ENST00000613104.1 | 581 | 124aa | Protein coding | CCDS58059 | P18847-5 | - | TSL:1, GENCODE basic, |
ATF3-201 | ENST00000336937.8 | 482 | 106aa | Protein coding | CCDS55688 | P18847-4 | - | TSL:1, GENCODE basic, |
ATF3-203 | ENST00000366981.8 | 680 | 175aa | Protein coding | - | Q5VTZ4 | - | CDS 3' incomplete, TSL:1, |
ATF3-205 | ENST00000366985.5 | 516 | 153aa | Protein coding | - | A0A0A0MRJ2 | - | CDS 5' incomplete, TSL:5, |
ATF3-207 | ENST00000464547.5 | 767 | 135aa | Nonsense mediated decay | CCDS41464 | P18847-3 | - | TSL:1, |
ATF3-209 | ENST00000492118.2 | 2103 | No protein | Processed transcript | - | - | - | TSL:2, |
ATF3-208 | ENST00000465155.5 | 1626 | No protein | Retained intron | - | - | - | TSL:2, |
Target Gene | ATF3 |
This KO Strategy | Normal |
Red Cotton™ Notes | Gene ATF3 had been KO in hct116 cell line. |
gRNA1(fw):TAACCTGACGCCCTTTGTCAAGG(87;0.74)
gRNA2(rev):TCAAACACCAGTGACCCAGGAGG(73;0.67)
gRNA2(rev):CAGAGGACATCCGGTGGCAGAGG(71;0.71)
Please leave your suggestion ×