CRISPR-U™ Gene Knockout Cell Line Strategy

ATF3 Gene Knockout Strategy

CRISPR-U™ technology (CRISPR based), developed by Ubigene, is more efficient than general CRISPR/Cas9 technology in double-strand breaking and homologous recombination. With CRISPR-U™, Ubigene has successfully edited over 3000 genes on more than 100 types of cell lines.
Objective
To create a Human ATF3 Knockout model in cell line by CRISPR-U™-mediated genome engineering.
Target gene info
Official symbol ATF3
Gene id 467
Organism Homo sapiens
Official full symbol activating transcription factor 3
Gene type protein-coding
Summary This gene encodes a member of the mammalian activation transcription factor/cAMP responsive element-binding (CREB) protein family of transcription factors. This gene is induced by a variety of signals, including many of those encountered by cancer cells, and is involved in the complex process of cellular stress response. Multiple transcript variants encoding different isoforms have been found for this gene. It is possible that alternative splicing of this gene may be physiologically important in the regulation of target genes.
Genomic regions Chromosome 1
Strategy Summary
This gene has 8 protein coding transcripts:
Name Transcript ID bp Protein Biotype CCDS UniProt Match RefSeq Match Flags
ATF3-211 ENST00000613954.4 2031 124aa Protein coding CCDS58059 P18847-5 - TSL:5, GENCODE basic,
ATF3-202 ENST00000341491.9 1940 181aa Protein coding CCDS1506 P18847-1 NM_001674.4 TSL:1, GENCODE basic, APPRIS P1, MANE Select v0.92,
ATF3-206 ENST00000366987.6 1917 181aa Protein coding CCDS1506 P18847-1 - TSL:1, GENCODE basic, APPRIS P1,
ATF3-204 ENST00000366983.5 858 135aa Protein coding CCDS41464 P18847-3 - TSL:1, GENCODE basic,
ATF3-210 ENST00000613104.1 581 124aa Protein coding CCDS58059 P18847-5 - TSL:1, GENCODE basic,
ATF3-201 ENST00000336937.8 482 106aa Protein coding CCDS55688 P18847-4 - TSL:1, GENCODE basic,
ATF3-203 ENST00000366981.8 680 175aa Protein coding - Q5VTZ4 - CDS 3' incomplete, TSL:1,
ATF3-205 ENST00000366985.5 516 153aa Protein coding - A0A0A0MRJ2 - CDS 5' incomplete, TSL:5,
ATF3-207 ENST00000464547.5 767 135aa Nonsense mediated decay CCDS41464 P18847-3 - TSL:1,
ATF3-209 ENST00000492118.2 2103 No protein Processed transcript - - - TSL:2,
ATF3-208 ENST00000465155.5 1626 No protein Retained intron - - - TSL:2,
Ubigene Red Cotton Transcript
Strategy
Click to get
Red Cotton™ Assessment    
Project Difficulty Levelloading
Target Gene ATF3
This KO Strategy Normal
Red Cotton™ Notes Gene ATF3 had been KO in hct116 cell line.
Aforementioned information comes from Ubigene database. Different origin of cell lines may have different condition. Ubigene reserved all the right for final explanation.
Frame-shift strategy
  • Pair1

    gRNA sequence:

    gRNA1(fw):TAACCTGACGCCCTTTGTCAAGG(87;0.74)

    gRNA2(rev):TCAAACACCAGTGACCCAGGAGG(73;0.67)

    gRNA2(rev):CAGAGGACATCCGGTGGCAGAGG(71;0.71)

Ubigene Red Cotton gRNA Positions Large
Ubigene Red Cotton gRNA Positions
Ubigene Red Cotton Transcript region
  • ATF3-203,ATF3-205 are incomplete transcripts, so these transcripts are not considered;
  • 4 exons are identified, with the ATG start codon in Exon 2 and the stop codon in Exon 4 (Transcript: ATF3-202);
  • Exon 2 is the target region, basing on start codon, exons location, exons size, and gRNA scores;
Note:It is possible to adjust the target region according to the actual situation during the experiment.
Data and information refer to following databases: NCBI, Ensembl, Crispor, ATCC.
Overview of the Dot Plot and GC Content Distribution
Dot Plot The ±800bp section of target region is aligned with itself to determine if there are complex sequence.
Ubigene Red Cotton Lattice Diagram
No complex region is found in the dot plot matrix.
GC Content Distribution The average GC content is 48.32% in the target region with its ±800bp section
Ubigene Red Cotton GC Content
This region is suitable for PCR screening or sequencing analysis
Work flow
Ubigene Red Cotton Workflow

Please leave your suggestion ×

Comment: