CRISPR-U™ Gene Knockout Cell Line Strategy

ARHGDIA Gene Knockout Strategy

CRISPR-U™ technology (CRISPR based), developed by Ubigene, is more efficient than general CRISPR/Cas9 technology in double-strand breaking and homologous recombination. With CRISPR-U™, Ubigene has successfully edited over 3000 genes on more than 100 types of cell lines.
Objective
To create a Human ARHGDIA Knockout model in cell line by CRISPR-U™-mediated genome engineering.
Target gene info
Official symbol ARHGDIA
Gene id 396
Organism Homo sapiens
Official full symbol Rho GDP dissociation inhibitor alpha
Gene type protein-coding
Also known as GDIA1, HEL-S-47e, NPHS8, RHOGDI, RHOGDI-1
Summary This gene encodes a protein that plays a key role in the regulation of signaling through Rho GTPases. The encoded protein inhibits the disassociation of Rho family members from GDP (guanine diphosphate), thereby maintaining these factors in an inactive state. Activity of this protein is important in a variety of cellular processes, and expression of this gene may be altered in tumors. Mutations in this gene have been found in individuals with nephrotic syndrome, type 8. Alternate splicing results in multiple transcript variants.
Genomic regions Chromosome 17
Strategy Summary
This gene has 8 protein coding transcripts：
Name Transcript ID bp Protein Biotype CCDS UniProt Match RefSeq Match Flags
ARHGDIA-201 ENST00000269321.12 1837 204aa Protein coding CCDS11788 P52565-1 NM_004309.6 TSL:1, GENCODE basic, APPRIS P1, MANE Select v0.92,
ARHGDIA-202 ENST00000400721.8 1568 160aa Protein coding CCDS58609 P52565-2 - TSL:2, GENCODE basic,
ARHGDIA-203 ENST00000541078.6 1517 204aa Protein coding CCDS11788 P52565-1 - TSL:3, GENCODE basic, APPRIS P1,
ARHGDIA-207 ENST00000580685.5 1201 204aa Protein coding CCDS11788 P52565-1 - TSL:1, GENCODE basic, APPRIS P1,
ARHGDIA-217 ENST00000584461.5 886 235aa Protein coding CCDS77133 J3QQX2 - TSL:2, GENCODE basic,
ARHGDIA-215 ENST00000583868.5 815 249aa Protein coding - J3KRY1 - CDS 3' incomplete, TSL:3,
ARHGDIA-208 ENST00000581876.5 709 129aa Protein coding - J3KRE2 - TSL:3, GENCODE basic,
ARHGDIA-205 ENST00000579121.5 637 193aa Protein coding - J3KTF8 - CDS 3' incomplete, TSL:3,
ARHGDIA-206 ENST00000580033.5 547 92aa Nonsense mediated decay - J3KS60 - TSL:4,
ARHGDIA-204 ENST00000578351.1 421 92aa Nonsense mediated decay - J3KS60 - TSL:4,
ARHGDIA-210 ENST00000582520.1 245 No protein Processed transcript - - - TSL:3,
ARHGDIA-211 ENST00000582984.5 823 No protein Retained intron - - - TSL:3,
ARHGDIA-209 ENST00000582309.1 628 No protein Retained intron - - - TSL:2,
ARHGDIA-216 ENST00000584397.1 622 No protein Retained intron - - - TSL:2,
ARHGDIA-212 ENST00000583111.5 574 No protein Retained intron - - - TSL:2,
ARHGDIA-213 ENST00000583499.1 560 No protein Retained intron - - - TSL:2,
ARHGDIA-214 ENST00000583791.1 351 No protein Retained intron - - - TSL:2,
Ubigene Red Cotton Transcript
Strategy
Click to get
Red Cotton™ Assessment    
Project Difficulty Levelloading
Target Gene ARHGDIA
This KO Strategy Normal
Red Cotton™ Notes Gene ARHGDIA had been KO in hek293t cell line.
Aforementioned information comes from Ubigene database. Different origin of cell lines may have different condition. Ubigene reserved all the right for final explanation.
Small fragment knockout strategy
  • Pair1

    gRNA sequence:

    gRNA1(rev):GGGCCTCCTTGTACTTTCGCAGG(90;0.65)

    gRNA2(rev):CTCGTTCTCCGCTGCAATCTGGG(88;0.66)

    Knockout size:106

    CDS Knockout size:106

  • Pair2

    gRNA sequence:

    gRNA3(fw):CTCGGTCAACTACAAGCCCCCGG(80;0.67)

    gRNA4(rev):AAACGGCCACGCGGCCCAGCAGG(82;0.72)

    Knockout size:82

    CDS Knockout size:82

Ubigene Red Cotton gRNA Positions Large
Ubigene Red Cotton gRNA Positions
Ubigene Red Cotton Transcript region
  • ARHGDIA-215,ARHGDIA-205 are incomplete transcripts, so these transcripts are not considered;
  • 6 exons are identified, with the ATG start codon in Exon 2 and the stop codon in Exon 6 (Transcript: ARHGDIA-201);
  • Exon 2 is the target region, basing on start codon, exons location, exons size, and gRNA scores;
Note：It is possible to adjust the target region according to the actual situation during the experiment.
Data and information refer to following databases: NCBI, Ensembl, Crispor, ATCC.
Overview of the Dot Plot and GC Content Distribution
Dot Plot The ±800bp section of target region is aligned with itself to determine if there are complex sequence.
Ubigene Red Cotton Lattice Diagram
No complex region is found in the dot plot matrix.
GC Content Distribution The average GC content is 64.92% in the target region with its ±800bp section
Ubigene Red Cotton GC Content
This region is suitable for PCR screening or sequencing analysis
Ubigene Red Cotton gRNA Positions Large
Ubigene Red Cotton gRNA Positions
Ubigene Red Cotton Transcript region
  • ARHGDIA-215,ARHGDIA-205 are incomplete transcripts, so these transcripts are not considered;
  • 6 exons are identified, with the ATG start codon in Exon 2 and the stop codon in Exon 6 (Transcript: ARHGDIA-201);
  • Exon 2 is the target region, basing on start codon, exons location, exons size, and gRNA scores;
Note：It is possible to adjust the target region according to the actual situation during the experiment.
Data and information refer to following databases: NCBI, Ensembl, Crispor, ATCC.
Overview of the Dot Plot and GC Content Distribution
Dot Plot The ±800bp section of target region is aligned with itself to determine if there are complex sequence.
Ubigene Red Cotton Lattice Diagram
No complex region is found in the dot plot matrix.
GC Content Distribution The average GC content is 64.92% in the target region with its ±800bp section
Ubigene Red Cotton GC Content
This region is suitable for PCR screening or sequencing analysis
Work flow
Ubigene Red Cotton Workflow

Please leave your suggestion ×

Comment: